Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YH24FM1
Length(NT) : 591
Best Gene Model Blast : Link to GSTUMT00008988001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12495
Accession: ref|XP_001586508.1| Score: 541 E_value: 8e-54
KEGG Definition: hypothetical protein
Accession: ncr:NCU08976.1 Score: 538 E_value: 9e-54
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG3071 Score: 191 E_value: 1e-15
PFAM Definition: ELO, GNS1/SUR4 family. Members of this family are involved in long chain fatty acid elongation systems that produce the 26-carbon precursors for ceramide and sphingolipid synthesis. Predicted to be integral membrane proteins, in eukaryotes they are probably located on the endoplasmic reticulum. Yeast ELO3 affects plasma membrane H+-ATPase activity, and may act on a glucose-signaling pathway that controls the expression of several genes that are transcriptionally regulated by glucose such as PMA1..
Pfam Number: pfam01151 Score: 198 E_value: 2e-16
Swissprot: P25358|ELO2_YEAST
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0009922 = Molecular function: fatty acid elongase activity
GO:0030497 = Biological process: fatty acid elongation
GO:0030148 = Biological process: sphingolipid biosynthetic process
GO:0016192 = Biological process: vesicle-mediated transport

Sequence:
>SY0AAA61YH24FM1
TTGGGTACCCTTTCACCATCTCCGAGTCCCTCTACACCGCTTTTCTCGAT
CCCAGGGTGCCATTATCGATTGCGGCAGCCTATGCCGCCGCCGTGCACCT
TCTCAATTCTCGATGCAACGGGAAACCATATTGCATTGCTACGACACGGA
TCTTCAAGGCGTTTGTACTGCTTCACAACCTCCTCCTAGCTGTTTACTCA
CTATGGACATTCATCGGCATGGCCGGCGCCATCCACCGATCAATAGTGAC
TTCTAGGGGAGTTCCGGGAGTGGTTGAGTCATTGTGCAAGATTAGACCCG
AGACCAGATTCGAGGGTGTGGAAATCAGAGAAATGGAAGGGGGTGTTGGA
CTCTGGGAGGAAGGATTAGCATTTTACGGATGGCTCTTCTACTTGAGCAA
GTTTTATGAGGTCCTGGATACTGCCATCATCATTGCGAAGGGAAAGAAGA
GTAGTCTTTTGCAAACCTATCATCACGCCGGGGCCATGATCTGTATGTGG
GCTGGAATAAGATTCATGTCACCACCTATCTGGGTCTTCTGCATCTTCAA
CTCACTGATTCATACCCTCATGTACTTCTACTACACCCTCT

Sequences in the Contig:

SY0AAA61YH24FM1