Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YH19FM1
Length(NT) : 386
Best Gene Model Blast : Link to GSTUMT00001664001 E-value : 1e-123
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_11529
Accession: ref|XP_001801769.1| Score: 133 E_value: 9e-07
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4452 Score: 108 E_value: 2e-06
PFAM Definition: UPF0197, Uncharacterised protein family (UPF0197). This family of proteins is functionally uncharacterised..
Pfam Number: pfam05251 Score: 106 E_value: 3e-06

Sequence:
>SY0AAA61YH19FM1
TTGGCTGAGCCGGGAATATTGCGACAAGAAAATACATACTTTCCAAATCG
AACCGAACGAATTTCGTTTACTATCGAAATAAAATGGACGCTGAGTGGGA
TTCAATGAAGCCCTTTGTGCCCATGGTTGGGAAAGGGGGACACCTTTTTG
TTGCGGCGGTCCTCATGTTGACAGGATTCTTTCTCACGGGGCTATTCTCT
ATAAATAAATCCATCATACGTGCCCCCCTATTGGCAATCCCAGCTTCTCT
AGCATTTGGGTTTGGATCCGTATACTTGATTTGCGCCGTCGGGGTCTACG
TTTAAGTGTTGAATGGTCAGCTAGGATATGGGGGGTTAAATTAAACTGTA
CGATTGGGCCTTGTTCTAAAAAGGGTGTTAAATATC

Sequences in the Contig:

SY0AAA61YH19FM1