Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YH09FM1
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00006734001 E-value : 1e-100
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_10729
Accession: ref|XP_001588282.1| Score: 203 E_value: 2e-23
KEGG Definition: hypothetical protein [EC:6.1.1.4]; K01869 leucyl-tRNA synthetase
Accession: ani:AN3702.2 Score: 187 E_value: 1e-22
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0437 Score: 113 E_value: 1e-06
PFAM Definition: No Hit Found
Swissprot: P10857|SYLC_NEUCR

Sequence:
>SY0AAA61YH09FM1
TTGGGTCATGATAGTTGTTGGCATGGCGAGCAGCTATTTTCAACAAATAC
AAGTCTGCACGCCAGACACTCCTTCCCAACCAGTAAAGTGGAATTTGCAA
CCGGTTACCAGCGTGCGCGAAACCTACCAGGAAGTGTCCGGCACCATTCG
CCCACACGGGGACCTGATATGCGGCTTTGTCGGAGTTTAAGCGTTGCAAA
TCACCCCCTTCACTCCCAACTGGGGAGACAACATCTACCTTGAAGTACAC
CGGAAGCCAATGGGCGTTCGAAAAGTCCTCTTCCCGACACCAGTGCACCA
ATCTCCACCGAACCCTCTTCTGCCCACTCTGACGTGCGGACAATAAATAC
AAACATACCCTCGACCAAACCCGCGGAAGCCAAGGGAAAAGCGAAGGGAA
AATCCGTTGCCTACAATGCTAACAAGCCCGAACGTCTCACCATCTTCGTA
GCGCCGGCATATCCGGCCTGGCAGAAAAGGTATATCGACCTCATCCAGGA
GACATGCGAAACGGTCACGTTACGTACCGACGATGGAGGGTTGACCACAC
GCATCTCGGGCATGGGTAAGGTGAAAAAGGCTAGGCACTTTGTGCAAGGA
ATCAAGCGCATGCTTTAGATGGAGGC

Sequences in the Contig:

SY0AAA61YH09FM1