Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YG14FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00002141001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_04193
Accession: ref|XP_361719.2| Score: 378 E_value: 1e-47
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04193 Score: 378 E_value: 5e-48
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2665 Score: 245 E_value: 5e-22
PFAM Definition: DAO, FAD dependent oxidoreductase. This family includes various FAD dependent oxidoreductases: Glycerol-3-phosphate dehydrogenase EC:1.1.99.5, Sarcosine oxidase beta subunit EC:1.5.3.1, D-alanine oxidase EC:1.4.99.1, D-aspartate oxidase EC:1.4.3.1..
Pfam Number: pfam01266 Score: 221 E_value: 4e-19
Swissprot: Q91YP0|L2HDH_MOUSE
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane
GO:0005739 = Cellular component: mitochondrion
GO:0047545 = Molecular function: 2-hydroxyglutarate dehydrogenase activity
GO:0044267 = Biological process: cellular protein metabolic process

Sequence:
>SY0AAA61YG14FM1
TTGGCTAGGAATGATTTTACGCATTGTGTCATAGGAGCGGGAGTTGTGGG
CTTAGCTGTCGCCAGACAATTATCCAAAAGGCCAGGAACAAGTACGTTAT
TACTTGAGCGACACAAAGCAATTGGTACAGAGACTTCGTCCAGGAATTCC
GAGGTCTTTCCTCCCTCCCTCCCTCCTCCCCCTACTAATCAATCTCTAGG
TGATCCACGCGGGCCTCTACTACCCACCCAACAGCCACAAAACCACGCTC
TGTAAGACCGGCAGCGCCCTTCTCTACGCCCTCTGCGAAAAGTACCACAT
CCCCTACCGGCGGACCGGCAAATGGATACTAGCGCAAGACTCCAGCCAAC
TCGAATCCCTCGAGCGCTTGCATGCTCACGCCCGCGCTCTCTCCATCCCT
ATGACATGGCTTACGTCCGAGCAAGCGCGCTCGCGGGAACCCGCCGTCCG
GGCGGAAGCCGGAGTTCTCGAGTCACCGCTGACTGGCATAGTAGACTCGC
ACGCGCTGATGACGTTCCTGCACGGCGATTTCGAGAGTGCCGGCGGTGAC
TTTGCTAAGGGCGCGCGGGTGGTCGACGTCCAGACGATTGGATCCGGCGG
GGATATGGGGTATAGGGTTGCC

Sequences in the Contig:

SY0AAA61YG14FM1