Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YG11FM1
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00002497001 E-value : 1e-161
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08185
Accession: ref|XP_001241022.1| Score: 342 E_value: 2e-55
KEGG Definition: hypothetical protein
Accession: fgr:FG06199.1 Score: 310 E_value: 2e-41
KOG Definition: No Hit Found
PFAM Definition: Methyltransf_11, Methyltransferase domain. Members of this family are SAM dependent methyltransferases..
Pfam Number: pfam08241 Score: 118 E_value: 3e-07

Sequence:
>SY0AAA61YG11FM1
TTGGGCCCGATACTGTATCGCTTGATACCTCGTTCGAAGCGACTATTCAG
ATACAAGGACGAACATACCAACAATGGGCTGTTGAGCACGGGACATCCTA
CGGACCCGTTGATGAGTATGAGCGCGAGAGACAGGAAACACAGCATGAAA
TTTTCAAGTTAGTTTTCGATCGAAAGTTAATATTCCCTCCAGTACACAAT
CCTAGAAAAATACTGGATTGCGGGTATGGATCCGGCAGTTGGGCGACAGA
TGTCGCCATGAAGTATCCCCATTGTGATGTCTGCCTCACCTCCAAAATCT
CCTAAGCCCCGGTACCGGCAAAGCGGCTTTTCTGACGATCGCCAGGTCAT
TGGAGTTGACATATCTCACCACATGATGCCTGATGACCCGCCACCAAATC
TCATTCTTCAGGTCGACGATCTTAACGAACCATTTACTTTTCACTCAAAT
GAGTTTGACTTTATACATTCTCGAAATGTGGTCACTGGTATCAACAAGGC
AAGATGGCCATCCTACGTGAGAGATTGCGCTCGGGTACTGAAACCAGGGG
GATGGCTACAAATGATAGAAATTTATCACAACGTGCAGTCAGATAACGGA
ACTATGACGGATAGGCACGCACTTCGAGAAC

Sequences in the Contig:

SY0AAA61YG11FM1