Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YE18FM1
Length(NT) : 598
Best Gene Model Blast : Link to GSTUMT00009602001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_00794
Accession: ref|XP_001598705.1| Score: 273 E_value: 1e-22
KEGG Definition: hypothetical protein
Accession: fgr:FG01638.1 Score: 238 E_value: 6e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA61YE18FM1
TTGGGAGCCATTATTCTCTCCAACCCCTTCTTCACCACATGATCGCCCCA
GGAAGCCTTCAGTACAGCAGCCCTTGCCGAGCGAGCAACGTGAACTGCGA
GGTACGGAATCGGGAGTAAAGTCACAAAAGCGGAAATCGACCGGCTACCA
TGATGCTGCCGGTAGAGGTTACGAATATGACATGGATAGTCGTAGAGCAG
ATGGCGGAAGTGGGGGTGAATTGACGGACGAGGGCCCCAGTCCTGTTTTG
AGATATCCGTCGCCTCCATCACAGAGACTTGCACACCGCATGCCTTATTT
CCGTTATTTCGGCCCTACGGCTATTGTGCCAGGCTACAAACAAATGGTTG
TTGAAGTACACGATAGGAATAACATACCTCGACATTCCAGTCTTTCAATG
AGTGCAAACTCTTCGGTGACATCGCCAGCATCAACATTTGTGAGTCTTGG
GAATCCAAACTCAACACCTACGGTTTCTTCCGGAACAAACAGTGTTCCAA
TGGAGGATATCCCTTTCTATGACCCTAGCGACCCTGCCCCAAATAACCCC
TTGATCGCCCACCTTGTCGAAACATTTTTTTCGCATTTGGGGTGTAAT

Sequences in the Contig:

SY0AAA61YE18FM1