Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA61YC18FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00010477001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: 78 kDa glucose-regulated protein homolog precursor
Accession: ref|XP_001247458.1| Score: 568 E_value: 6e-57
KEGG Definition: hypothetical protein; K09490 heat shock 70kDa protein 5
Accession: ani:AN2062.2 Score: 540 E_value: 6e-54
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0100 Score: 553 E_value: 1e-57
PFAM Definition: HSP70, Hsp70 protein. Hsp70 chaperones help to fold many proteins. Hsp70 assisted folding involves repeated cycles of substrate binding and release. Hsp70 activity is ATP dependent. Hsp70 proteins are made up of two regions: the amino terminus is the ATPase domain and the carboxyl terminus is the substrate binding region..
Pfam Number: pfam00012 Score: 458 E_value: 1e-46
Swissprot: P83616|GRP78_ASPNG
Gene Ontology:
GO:0005788 = Cellular component: endoplasmic reticulum lumen
GO:0006986 = Biological process: response to unfolded protein
GO:0045045 = Biological process: secretory pathway

Sequence:
>SY0AAA61YC18FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCAAAATCTGTAGACTGGTACTCTCAGAAACAATCATCCGCCAA
CTGCTACGACCTTTAAGCTTTTTCATCTTTTATCCAAAGGCTGCCCCTGA
TGTTTGAATCCAAGGGCAAGGGGGTCACTTGGACCACTATACTTTACTTA
TTTTGCATTTTCCTAGCACCTCTCCTGTTTCTCTCTCCAGCAACCGCTGC
GGAGAACGAGACTGACAACTTCGGAACTGTTATCGGTATTGATTTGGGAA
CTACCTACTCATGTGTTGGTGTTATGAAGGGTGGTCGTGTCGAAATCTTG
GTCAATGATCAGGGAAATCGTATTACTCCTTCCTATGTCGCTTTCACGCC
TGATGAACGTCTTGTCGGTGATGCCGCGAAGAATCAATATGCCTCTAATC
CCCAAAACACCATCTTTGACATCAAGCGTCTCATCGGACGTAAGTTCAAC
GAGAGGGATGTACAGAATGACATGAAGCACTTTCCCTTCAAGGTCATCAA
CAAGAATGGTCAGCCCGCTGTCCAGGTCGAGGTTGGTGGTGAGGAGAGGG
ATTTCACTCCCGA

Sequences in the Contig:

SY0AAA61YC18FM1