Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YO16FM1
Length(NT) : 566
Best Gene Model Blast : Link to GSTUMT00012239001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG03696.1
Accession: ref|XP_383872.1| Score: 578 E_value: 4e-58
KEGG Definition: hypothetical protein
Accession: fgr:FG03696.1 Score: 578 E_value: 2e-58
KOG Definition:
Classification: [Energy production and conversion, General function prediction only].
Kog Number: KOG2614 Score: 154 E_value: 2e-11
PFAM Definition: FAD_binding_3, FAD binding domain. This domain is involved in FAD binding in a number of enzymes..
Pfam Number: pfam01494 Score: 126 E_value: 3e-08
Swissprot: O81360|ABA2_PRUAR
Gene Ontology:
GO:0009540 = Molecular function: zeaxanthin epoxidase activity

Sequence:
>SY0AAA60YO16FM1
TTGGCGAGACCTTCGTCGGAGACGTGGTCGTCGGTGCGGACGGCGTCAGG
AGCAGAGCCAGGAAGTTAGCGCTCGGCTTGGACGACAGGGTCAAGTCCAC
TGGCTATGCTGTGTATCGTGCATGGTTCAACGCCGAGGAGCATGGGATCC
TGGACGACTCACTTACGAGGGAATTCGCGGAGCGGGGGGACACGCACACA
GGTTGGCTAGGACCCGATGTTCATTTGCTTGTGGCTACGTGTAAAGGAGG
GCGAGAGCTGTCGTGGGTTTGCACGCATAAGGACGGCGGGGACATTGACG
AATCATGGTCCTATCCCGGACGTGTGGAAGATGTTCTAAAGCTTCTGGAA
GGCTGGGACCCAAGATGCAGGGCAATCGTCGCCAAAACCCCCTCGTTAGT
GGACTGGAAACTTGTCCATCGGGAGCCCCTTCCCACATGGATTAGCCCGG
GCGGTCACATATGTTTAATCGGAGATGCCGCTCACCCATTTTTACCCACT
TCAATACAAGGCTGTTCCCAGGCGATTGAGGACGGCGTCGCCCTGGCCAC
GATCCTCTCCTTAACC

Sequences in the Contig:

SY0AAA60YO16FM1