Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YO03FM1
Length(NT) : 577
Best Gene Model Blast : Link to GSTUMT00002496001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: nonribosomal peptide synthase 2
Accession: gb|ABU42595.1| Score: 340 E_value: 2e-30
KEGG Definition: hypothetical protein
Accession: mgr:MGG_12175 Score: 301 E_value: 3e-26
KOG Definition: No Hit Found
PFAM Definition: Condensation, Condensation domain. This domain is found in many multi-domain enzymes which synthesise peptide antibiotics. This domain catalyses a condensation reaction to form peptide bonds in non- ribosomal peptide biosynthesis. It is usually found to the carboxy side of a phosphopantetheine binding domain (pfam00550). It has been shown that mutations in the HHXXXDG motif abolish activity suggesting this is part of the active site..
Pfam Number: pfam00668 Score: 212 E_value: 3e-18
Swissprot: O43103|SID2_USTMA

Sequence:
>SY0AAA60YO03FM1
TTGGAGGGATTAGTCGGGGAAGAGCTACTCCCCAAGTTCACAGAGCGCAT
ACAAAAGGCGTGGAAGTCTCTGAGACATGACGAGATTGAGGCAATTTACC
CAACCACACCACTTCAGGAAGCCATGATAGCCGAAACCCTAGCTTCAGAC
TACCAATTGTATTTCAACCATGATGTCTTGGAGCTAGAGGACTGGGTCAA
CACTAGTGATCTCCGACGAGCCTGGGCTGCGGTGGTCGAACGGTCCGAAA
TTCTAAGAACAAGCTTCTTCAGCGCATCTGATCTATTCCCAGAATCACCG
TGCACCTTTGGCCAACTAGTTCACAAGCGGTCAAAATTCCACTGGGGTGA
AGTAACCGTGGCCAAGAATGACGATCTCCACGCCGCTTTCAAGAAGGTCA
TGCAGGAAGCTACCGAGAAGGTTGACATGCTCAAAGAGCCTCCTTTCAGA
GTTGCGATCGTGCACAGCCCCAAGACTAGACATTTCATACTTTCTATATC
TCATGCTCTCTATGACGGGTGGTCTATTGCATTACTGCATGAGGACGTAC
AGAGGGCATACCATGATTCACCAACTC

Sequences in the Contig:

SY0AAA60YO03FM1