Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YN24FM1
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00007246001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: PREDICTED: similar to WD repeat domain 24 isoform 1
Accession: ref|XP_001365745.1| Score: 490 E_value: 8e-48
KEGG Definition: LOC100017039; similar to WD repeat domain 24
Accession: mdo:100017039 Score: 490 E_value: 4e-48
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0269 Score: 595 E_value: 1e-62
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 127 E_value: 3e-08
Swissprot: Q5ZMV9|WDR24_CHICK

Sequence:
>SY0AAA60YN24FM1
TTGGCGAACGGGACTATCTGCGTCTACGATACTAAGGATGGGATGCTGGA
CCGCCAATTGAGAGAGCATGGGAGACAGGTGCATAAGGTGGCGTTCAATC
CCGCGGATGGGAGGCTGCTGTTGAGCGCTAGTCAGGACGGGACTGTCAAG
CTTTGGGATTTGAGGGAGAAGAAGAGTCGGCTGACGTTTGTGGGGAGGGC
GGATGCGGTGAGGGATGTGCAGTTTAATGCTGGGAATGCGGTAGAGTTTG
CCGCGGCGTTTGACAATGGGACAATTCAGAGGTGGGACTATCGAAAGGAT
AATACTTACGAGAGGAGTCTTAGCGCTCACAATGGACCTGCGTTCACGGT
GGATTGGCACCCGGATGGAAAGCACTGTGCTAGTGGTGGTAGGGATAGAA
CTGTGAAGGTATGGGATTTTTACGCTGATCCTAGGCAAAAAGCGAAACAT
ACGATTTCTACCATGACGTCTGTTAGTCGGATTTCCTGGCGGCCGTTGAA
ACAAGTGACTACGGAGTTGGCCACCTGTGCGATAGGTAATGATCACAGAG
TTCACGTATGGGACCTGAAGCGTCCTTATATCCCCACGAGGATAATGGAT
GAGCACGAGAATGCCGTTACGGGTATTCTCTG

Sequences in the Contig:

SY0AAA60YN24FM1