Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YK02FM1
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00006304001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_03303
Accession: ref|XP_360760.2| Score: 265 E_value: 1e-21
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03303 Score: 265 E_value: 5e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q5B4D1|GRC3_EMENI

Sequence:
>SY0AAA60YK02FM1
TTGGGTCGAAACGGAGACGGACACGAAGGTTGATAAAGAGGTCCGGATGT
CGAATTTCACACTCACTTCTGAAAACTACATTCCCGCTCAAGATGGGAGT
TGCGTTGTCCGGATGGCACCCGGGGAGACTCTTGTGATCCTTGGGGAATA
CGAACTCCGCGTGAGAAAAGGGGCCATCACTATCTCCGGCGCAAAATTAA
CTCGCCAGTCCGGGTGTTGTCAGGTGTTTGCACCGAGCACGCATGCCTTA
CCAGAGATCGCCTGCGTGAAGGTTAAGAGGAAAGGAGAGGATTCTGATGC
GGAGGTTTTATTCACGCAGGCGGAGTCTGGGATACGGAATTTGGGGAGGA
CATGTCCGGTTGCTAATGGGATTTGGGTGCCAGTTGGGGGGGATGGCGGG
AGGTCTTTCCATCCATTGTTTACCACGAGCGCACCCTTACCGGTTCTCAC
TATTCCGAAGCAGTGGGAGGAGACGCTCGGGGGAATTGAGAAGGTCGCTA
ATCCCGGAAATACCGCACCCCCGGTCATTCTCCTTTCTGGGGGAAAGTCG
GTTGGAAAGTCCACACTCTCTCGGATCTTCACGAACCGGCTCCTCACCGC
AGAAACCTACCCGAGAGTCTACTACTTAGACGTCGACCCGGGTCA

Sequences in the Contig:

SY0AAA60YK02FM1