Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YK01FM1
Length(NT) : 482
Best Gene Model Blast : Link to GSTUMT00005151001 E-value : 1e-117
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_02619
Accession: ref|XP_001248848.1| Score: 257 E_value: 4e-21
KEGG Definition: 6-phosphofructo-2-kinase, putative
Accession: afm:AFUA_6G05100 Score: 251 E_value: 1e-20
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0234 Score: 120 E_value: 1e-07
PFAM Definition: 6PF2K, 6-phosphofructo-2-kinase. This enzyme occurs as a bifunctional enzyme with fructose-2,6-bisphosphatase. The bifunctional enzyme catalyses both the synthesis and degradation of fructose-2,6-bisphosphate, a potent regulator of glycolysis. This enzyme contains a P-loop motif..
Pfam Number: pfam01591 Score: 116 E_value: 3e-07
Swissprot: Q06137|YL345_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0003873 = Molecular function: 6-phosphofructo-2-kinase activity
GO:0005515 = Molecular function: protein binding
GO:0006003 = Biological process: fructose 2,6-bisphosphate metabolic process
GO:0006110 = Biological process: regulation of glycolysis

Sequence:
>SY0AAA60YK01FM1
TTGGATTTGCGGGGCTATTATGCGGTGTAAAAAGTGATGCGAGTATGATA
ATTAGTTTTATCAGAACTCATTATTCACTCTTTCTTTGAGAATTGCCAAG
ACCACCCATTTCTCCTCATTGGCGCTAACGACCCAGAGTTCGGTTGTGAG
CAGAAGGTAAGGACGAAAGCTCCCCCTGAATTACCTACCGGAACAACATC
ACTTGTCTCCGTCCTATAAAAAAAATAAAAATAGCGGCTATCTTAACTGA
GTTTGAATTCATCTGAATTACAGCAATGATGCCCCTGTCTCTCGTCTCCG
TCGGAGGTCCAATGTCAACATCGATGCCATTCATGACTTTCCTGTCGATA
GTGAGATGGCCCCGGCTCAGTTGTATTCCACAGAGTCCGGTAGGTTGTTC
CACTCGGGAAAGATCGCAATCGTAACTGTTGGGTTACCGGCTAGAGGGAA
AACGCACGTTTCTGTGGCTCTCTCTAGGTATC

Sequences in the Contig:

SY0AAA60YK01FM1