Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YF08FM1
Length(NT) : 397
Best Gene Model Blast : Link to GSTUMT00006195001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_00463
Accession: ref|XP_001219684.1| Score: 147 E_value: 2e-12
KEGG Definition: hypothetical protein
Accession: ncr:NCU02432.1 Score: 142 E_value: 4e-12
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0717 Score: 208 E_value: 4e-18
PFAM Definition: No Hit Found

Sequence:
>SY0AAA60YF08FM1
TTAGGGATGCAGGGATGAGGGAGTTTAATGATTCTGTCAGGTCCTTCGTT
CTCTTCATACGGAAACGTGACCCCCGGTTCATCAAGAATACCCAGAGCGA
GGCTCAACGTCAGGCGGCTCTTCTCGCGGCATCTAGGGAGCAAGCGGCGC
GTCAACGCAAGGAAAATCTCGCCAAGTTAAAAGAATTCAAGGCTGCAGAT
TGGACCCAGGCGTCTCACAAGGCTGAGGACTACTCCGACGATCCTGACGA
GGACGAAGAAGTCGAAGAGGAGGAAATAATCGAGAAATATGAGTGCATTG
TTTGCAAGAAGACATTTTGGTCGGAGGGACAAATGGGAACACGAGAAGAG
CAAGAAGCATGTCAAGAATGTGCAGGCACTGAAACGACAAATGATGA

Sequences in the Contig:

SY0AAA60YF08FM1