Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YF04FM1
Length(NT) : 586
Best Gene Model Blast : Link to GSTUMT00003915001 E-value : 1e-169
Numbers of ESTs : 1

Blast Results:

Nr Definition: ubiquitin conjugation factor E4
Accession: ref|XP_001244623.1| Score: 309 E_value: 6e-27
KEGG Definition: hypothetical protein [EC:6.3.2.19]; K10597 ubiquitin conjugation factor E4 B
Accession: yli:YALI0D12452g Score: 289 E_value: 7e-25
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2042 Score: 285 E_value: 1e-26
PFAM Definition: U-box, U-box domain. This domain is related to the Ring finger pfam00097 but lacks the zinc binding residues..
Pfam Number: pfam04564 Score: 240 E_value: 2e-21
Swissprot: P54860|UFD2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0004842 = Molecular function: ubiquitin-protein ligase activity
GO:0006950 = Biological process: response to stress
GO:0006512 = Biological process: ubiquitin cycle
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>SY0AAA60YF04FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGTGAGGTGGAGCTCGGTGAGATTCCGGATGACTTTCTGGATC
CATTGATGGCAACATTAATGGAAGATCCTGTCATCCTCCCCTCTTCCAGA
GTCACTATCGATCGCCAAACTATTAGAATCCATCTCCTGGGAAATCCTCT
AGACCCCTTCAATAGGTCCCCACTGAAAGTTGAAGATGTCATTTCGAACA
CCGAACTCAAAAACCAAATACAAGCATGGATCAAGGAGCGACGTGCAAAA
GGCACTATCAAGGACGACAACGGTGACGAGGAAGCGATGGACCTTGACCC
CTAAACCTTTAATGAGGTGGGTTACAAAAAAGGCTTGCTCCTACATTTTA
TAAGCACCATAAAACAAATGGGGCACATGGCTATTATTAAATGTGAACCC
AAATAATGGAGTGCACACCTATTTGAACTGTTCTTTTTTGCCACATTAAT
TTTTTATTTTCATTGCTATGATACTTCCACCATTGAGTCATTGCCAATAA
AGATGTTGTACCGTACGTAATACAAGGAGTTTTTTC

Sequences in the Contig:

SY0AAA60YF04FM1