Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YD13FM1
Length(NT) : 618
Best Gene Model Blast : Link to GSTUMT00009031001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001558123.1| Score: 779 E_value: 2e-81
KEGG Definition: conserved hypothetical protein
Accession: mgr:MGG_04150 Score: 756 E_value: 5e-79
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1061 Score: 508 E_value: 2e-52
PFAM Definition: Adaptin_N, Adaptin N terminal region. This family consists of the N terminal region of various alpha, beta and gamma subunits of the AP-1, AP-2 and AP-3 adaptor protein complexes. The adaptor protein (AP) complexes are involved in the formation of clathrin-coated pits and vesicles. The N-terminal region of the various adaptor proteins (APs) is constant by comparison to the C-terminal which is variable within members of the AP-2 family; and it has been proposed that this constant region interacts with another uniform component of the coated vesicles..
Pfam Number: pfam01602 Score: 237 E_value: 4e-21
Swissprot: P52303|AP1B1_RAT

Sequence:
>SY0AAA60YD13FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCTCGATTCTCTGGACGAGC
CGGAAGCCAAAGCGGCCATGATCTGGGTTATTGGCCAATACGCGGACAGG
ATTGAGAACAGTGATGTCCTTCTCGAAGACTTCCTCTTTTCCTTCCAGGA
CGAACCAGTAGAAGTGCAACTCGCGCTGCTGACAGCTACTGTGAAACTCT
TCATCCAACGCCCAACAAAGGGACAAGATCTGGTACCAAAAGTTCTCAAA
TGGGCGACTGAAGAAACAGATAACCCCGATCTTCGTGACAGAGGTTACAT
GTACTGGCGACTGCTCTCGGCAGACCCTGCAACAGCCAAGAAGGTAGTGA
TGGGCGAGAAACCGCCCATCACAGCGGAGACTGAGAAACTGGACCCCACT
ACTCTTGAAGAAATGTGTTTGAACGTAGGAACTCTAGCAACAGTCTATCT
CAAGCCCGTTAATCAGGTGTTCCGAACTGCCCGCCCAAAGAGATTGGCGG
ATAGCCCGGCTTTACAGAGGCACACGCTTCCAACGGCGATCGCTGAACAG
GCGCATAGGAGAGCGCTCCAGCCTGAGCAGCAGCAGCAGCAGCCAGTGGA
GCAGAGGACTTCAGAGGA

Sequences in the Contig:

SY0AAA60YD13FM1