Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YD09FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00009557001 E-value : 1e-150
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_03458
Accession: ref|XP_001794021.1| Score: 124 E_value: 4e-10
KEGG Definition: hypothetical protein
Accession: ncr:NCU02773.1 Score: 106 E_value: 4e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA60YD09FM1
TTGGCTTGGACGGTCGTAATCACCTCACTCAAGTTACCAGCCACGGTTAG
TAGTTGGCAGTTAGCAATCGAATACCCCCCCTTCCTCTTACGGAATCTAC
TGGACGAGAAAAAGGAGAAGAAAAGTATTAATTGTGATTTTTTTTCCTTC
TCTTAAAGGACGCGGAGGAGCCGGAAACATCGGCGTAGACGAACATCCCC
ACGAAGCATCCCCTGAAGACATCCGCATCCCGACCTTGAAAAGCCCAGTA
TATACCACCGGCCGCGGCGGAACAGTAAAAATCTCTCTCTGTCCCTATCT
ATCTCCCTACAAAGCTAACTTCTTACCTATGACAACCAGGGCAACATGGC
CGTTAACGACCCCGCCCATCCAGAACTCGCACGCGCAGCACAAGACGTCG
AAGAACCTAGGCGTCCTAGTAGCTCTGACTCCTTCCATGGCGGTCGCGGA
GGTGCAGGTAACATCGTCCACCCTACCGATTCAGACCTCGTGAAGCTCCG
CCTTGAAGAGGAGGAGCGACAGCGCCTTGCGGCCGAGATGGCAAAACCGA
GGCCCATCGATCATACTAAGATTGACTATGGAGGCTGGGCAGATAAAGGG
AAGGACTACTTGCGAA

Sequences in the Contig:

SY0AAA60YD09FM1