Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YD05FM1
Length(NT) : 569
Best Gene Model Blast : Link to GSTUMT00002767001 E-value : 5e-53
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001218534.1| Score: 572 E_value: 2e-57
KEGG Definition: hypothetical protein
Accession: ani:AN3547.2 Score: 458 E_value: 2e-44
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 277 E_value: 9e-26
PFAM Definition: No Hit Found
Swissprot: P46825|KLC_LOLPE

Sequence:
>SY0AAA60YD05FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGTGCATTAGCGGGTAGGG
AGAAAAGGCTCGGGTGGGACCATCCAGATACCCTTTATAGTGTCGAAAAT
CTCGGCGGGACTCTGCATAGTCAAGGAAAGTACGACGAAGCTGAGATTAT
CCATCGACGTGCGTTAGCGGGTAGGGAGAAAAGGCTCGGGTGGGACCATC
CAGATACCCTTTATAGTGTCGAAAATCTCGGCGGGACTCTGCATAGTCAA
GGAAAGTACGACGAAGCTGAGATTATCCATCGACGTGCATTAGCTGGTAG
GGAGAAAAGGCTCGGGCGGGATCATCCAGATACCTTTAATAGTGTCGGCA
ATCTCGGCGTGACTCTGCATAGTCAAGGAAAGTACGACGAATCTGAGAAT
ATGCATCGACGTGCGTTAGCGGGTAGGGAGAAAGGGCTCGGGTGGGACCA
TCCAGATACCCTTTATAGTGTCGGCAATCTCGGCGGGACTCTGCATAGTC
AAGGAAAGTACGACGAAGCTGAGATTATGTATCGACGTGCATTGGCAAGT
AGGGAGAAAAGGCTCGGGT

Sequences in the Contig:

SY0AAA60YD05FM1