Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YC20FM1
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00000210001 E-value : 1e-127
Numbers of ESTs : 1

Blast Results:

Nr Definition: SH3 domain protein
Accession: ref|XP_001272817.1| Score: 201 E_value: 2e-14
KEGG Definition: hypothetical protein
Accession: ncr:NCU03113.1 Score: 188 E_value: 4e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA60YC20FM1
AGAATGCGCTGGGAATCCGTCCGCGACTTTGCCTATCCGGCGCTTCACCC
GCTACACTACGGCCCCTCGTCCGCTACGTCCGGCCTATCCACGCCTACGG
ATTCCCAGCGCAGTTCTCAATACTTTGACCATGGTAGTAACCATGGAGGC
CAGGCTGGTACCTGGTTTACGGGGGGTGGGAGCGGTTATCGGAGGTTATC
TGATCCCGCACATCCCTCCTATGACTTTGGTGTAGGTGGGAATGCGGCAT
GGGGCGGGGACTCGTCCAGGCAACGATCGAATCATAATAGCAATCATCCG
CATCACCATCACCCCCCGCCGCTGAATTTCTCCGACGGTCCTCCTTGGAG
CGAAGATGAAGATTTGCAGAGCCCGGTTGTCGTGTCCAAGCACAGAAAGC
ATAAATCTTCCGCAGCGCATTTGCAAACTAGTTCTCAGCATTCCAGGGGC
CAGAGCAAGAACGCCATCACACCCACTACGCTTCAACACTTTGCCGGGAA
TAGCCATGGCGTCAGCGGCGGTGGGTGTGGGCCTGGGAGGGGGGTCGGCA
ATGGCGATGCTGGATGTGGGGGTGAGGACGAAGACTGGGACGGGGAACGT
AGATCGATTTTGGAGAACGG

Sequences in the Contig:

SY0AAA60YC20FM1