Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YC17FM1
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00007759001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_09103
Accession: ref|XP_001799405.1| Score: 588 E_value: 4e-59
KEGG Definition: hypothetical protein
Accession: ang:An17g02080 Score: 538 E_value: 1e-53
KOG Definition: No Hit Found
PFAM Definition: CorA, CorA-like Mg2+ transporter protein. The CorA transport system is the primary Mg2+ influx system of Salmonella typhimurium and Escherichia coli. CorA is virtually ubiquitous in the Bacteria and Archaea. There are also eukaryotic relatives of this protein. The family includes the MRS2 protein from yeast that is thought to be an RNA splicing protein. However its membership of this family suggests that its effect on splicing is due to altered magnesium levels in the cell..
Pfam Number: pfam01544 Score: 233 E_value: 2e-20
Swissprot: O13779|YF2E_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005887 = Cellular component: integral to plasma membrane
GO:0015095 = Molecular function: magnesium ion transmembrane transporter activity
GO:0015693 = Biological process: magnesium ion transport
GO:0010045 = Biological process: response to nickel ion

Sequence:
>SY0AAA60YC17FM1
TTGGCACTCCCATGTTGCGGCAGATTGGCGAATGTCGGAAGAAGTGCATG
ACCTTGATGAGACTGTTGGGCGGCAAAGCCGATGTTATTAAGGGATTTGC
AAAGAGATGCAACGAGCAATACCAAGTCACTCCTCGTGGTGAAATTGGAT
TGTATCTCGGTGATATTCAAGATCACGTCGTCACGATGATGGGCAGCTTA
TCTCACTTTGAGAAAATGCTTTCCCGCTCGCACGCCAACTACCTCGCGCA
GCTCTCGGTAGACTCTATCCAAACCAATAATCGTGCCAACGAGGCCCTCG
GGAAGATTACAACCATCGCGACAATTCTCGTCCCGCTCAACCTAATTTGC
GGTCTCTTTGGCATGAATGTAACAATTCCAGGCCAACACGACCCACACCT
TTACTGGTTTTTTGGAATCCTGGCAAGCATCTTTCTGTTCGTCACCGTGT
CCTTCTTCCTCGCGAAGCGATGGAGATTTATATAAATTTGCCATTTGCTT
TTTATTCCCTTCCTAGTGGCTTCTTATGAAGAAAAAGAAAAAAAGAAAAT
GTCCCGGGCGACGTCTTTTTAATTTTGTTTTCTGGGAGACTATTCCTCAG
GCTTGTGCCTTCCTTTGAGATTGCTGTGTCTTTCTCCGTGTTAAATTGTT
GCTTTTTTGGGTTTCCTTTCACCTTGTTTA

Sequences in the Contig:

SY0AAA60YC17FM1