Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA60YA09FM1
Length(NT) : 471
Best Gene Model Blast : Link to GSTUMT00011472001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04993
Accession: ref|XP_001245552.1| Score: 239 E_value: 5e-19
KEGG Definition: polyadenylate-binding protein
Accession: afm:AFUA_1G04190 Score: 231 E_value: 2e-18
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0943 Score: 111 E_value: 1e-06
PFAM Definition: PABP, Poly-adenylate binding protein, unique domain. The region featured in this family is found towards the C-terminus of poly(A)-binding proteins (PABPs). These are eukaryotic proteins that, through their binding of the 3' poly(A) tail on mRNA, have very important roles in the pathways of gene expression. They seem to provide a scaffold on which other proteins can bind and mediate processes such as export, translation and turnover of the transcripts. Moreover, they may act as antagonists to the binding of factors that allow mRNA degradation, regulating mRNA longevity. PABPs are also involved in nuclear transport. PABPs interact with poly(A) tails via RNA-recognition motifs (pfam00076). Note that the PABP C-terminal region is also found in members of the hyperplastic discs protein (HYD) family of ubiquitin ligases that contain HECT domains - these are also included in this family..
Pfam Number: pfam00658 Score: 231 E_value: 2e-20
Swissprot: Q1DXH0|PABP_COCIM

Sequence:
>SY0AAA60YA09FM1
GTTCAACCCGGTCGCGGCGGTCCTCGGGGCAATCTTCCTCCCCAGACACA
GCCCGGTCGTCCTCCCGCCCCTCCCCAGATTCCACATGTATCTACCAGTG
GAATTGATCCCACCCTATTTGCTGCCTCGCCTCCTCAGGCCCAGAAGCAA
TTGCTTGGCGAATCTCTCTATCCCAAGATCCAGCGCCAGCACCCTGAGCT
TGCTGGAAAGATCACCGGGATGTTGTTGGAGATGGACAATATGGAGCTTC
TCGCACTTCTTGATGACGAGCAAGCTCTAATCGCCAAGGTCGACGAAGCT
CTTAGTGTCTATGACGAGTACGTTAAGACTCGAACCGGTGATGATATCGG
GGGTCACGAGGGTGCCACAACTAATGATAATGAGAACAAGGGTGATGAGG
GCAAAAAAGAGGGTGAAATTAAAGGTTAAGCTTTGGGCGTCTTTGGGATA
GAACTTTTTTTTCTTCTCTTT

Sequences in the Contig:

SY0AAA60YA09FM1