Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YP11FM1
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00011612001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_499696.1| Score: 321 E_value: 2e-41
KEGG Definition: hypothetical protein
Accession: yli:YALI0A02541g Score: 321 E_value: 1e-41
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2544 Score: 303 E_value: 1e-28
PFAM Definition: HPPK, 7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK)..
Pfam Number: pfam01288 Score: 220 E_value: 5e-19
Swissprot: P29251|FAS_PNECA

Sequence:
>SY0AAA5YP11FM1
TTGGCGCGTTCGAGCATTTTCGGATGCGGGATTGTGAGGTGTGGAGTTTC
GAGTACAAGATTGTCGTAGAGGAGTATGTCTAGGTCTATCGATCTGGGTC
CGTTCTCGATACTTTTTAATCGACCGAGGAGGGATTCTATATCCTTTAAG
GTCTCTAATAGGACGTCTGGGGATAGTGTTGTCTCTACCTGTTACATGTT
AGCATCCATACCAATACCTACCGCCAGATGTGAAGATGACCTGAATAACC
CCATTCAAAAACGTCGGCTGATCAAGGTAATACATCGGGGCACTCTGATA
CAAACTGCTCGTTTTCTTAACCTTTATCCCCCTTTTTTCTACTTCTGCGA
CAGCGTCTTTTATGGCTTGAAAGCGGTCTCCAATATTACTACCTAAAGCG
ATGAATGCATCATGATTTCCCTCTACTTCTGCTGCGGCTTCTTCTAAAGC
AAAGAACGACCTCTCCCTGGTAATCTCCACCCCCGGCCCCTCTGCAAACG
TCAGAGCACTCGGCTTCTCCGCCCGCACCGTAATCTTCGAAATCCCACAC
CCGATACAAGCCTCCTTCGCGACGGCCGTAACAAGCGCCTCGACCGTCTT
GTAATCCGAGGCTTCAACATGCTCTGTCACGTACTTAGCCACGGAACGGA
AG

Sequences in the Contig:

SY0AAA5YP11FM1