Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YP08FM1
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00002092001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215590.1| Score: 302 E_value: 5e-26
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 287 E_value: 2e-24
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA5YP08FM1
TTGGCATTCACTTCCTACGACGACAAATCACCTTCCTGCAGTTTAAGCAT
CTGCCGATCATAATCGAGTATGGAAAATAGGCAATCAGACACACAGTTCG
AGGAACTTCCCTCGTCCCAACGCTATACCTCAAGCACTGCGACCGAGAGC
AATATCCAAGGCCACTATAGCGGCAACTCCAGCTCCATCAACATCTCCGG
TTCCGGTAATACCACCCACAATGCTTATTACGACTACGGGGACAGGGGTT
GGTCCCGGAGACACGAAGAAATTTTGCAATGCCTATACACGTCTAAATAC
GAGGAACACTGGGATCGGGTTCGCAAACCAGCGGAAGGAACATGCACCTG
GGTAACGGAACATCCGAGATATAAGGGCTGGTTGGAAAATAAATCATCTG
GTGTCCTGTGGCTATCCGCGGACCCTGGTTGCGGGAAATCGGTCATCGCT
TCCTTCCTCATAAAGGATCTGGAGCGCCACACGGATGCCAACGTTTGCTA
CTTCTTTTTCAAAGATGATAGCGAGGAACAGAGGAGCGCAACATTTGCTC
TTTGTGCCATACTACATCAGATTTTCAGGCGGGGAACGCACCTCATTGAC
TTTGCGGAGGAAGAGTTTAAGGCCAAGGGCAAGGGGTTTACAGAGGAGGT
CAATACACTGTGGAATATTT

Sequences in the Contig:

SY0AAA5YP08FM1