Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YN18FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00004811001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65571.1| Score: 220 E_value: 2e-16
KEGG Definition: ankyrin repeat
Accession: aor:AO090103000097 Score: 220 E_value: 9e-17
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 120 E_value: 2e-07
PFAM Definition: No Hit Found

Sequence:
>SY0AAA5YN18FM1
TTGGGGGGAATATAGACCTTCAGATGGAAAATGTCCCTTCGATAGGGGCG
GTGTTGGGCTGTACTTTAGGACTTGTTACGATGGATGAACAAGAATCGAC
AGTCAGTCTCAGGCATTTCACTCTCCAGGAGTATCTAGGAGCACATACCA
GCCTATCCACCACTCCTCACTCGATGATAGCTGAAATATGCCTTACATAT
TTAAACTTTCAGTTCGTCTCGGATCTCCCAACAACCCTCAATGTTACCAC
ACCTATGACGCCACTTCTCCGCTATGCATCGTGTTATTGGGGATCCCATG
CTAAGCGGGAACTGTCCGAGAGAGCGAAATCTCTGGCATTGCAAGTCCTC
ACACAGTATCCGGAACATATATCTGCTAATATTCTCCTGGACGAGATGAT
TTTGAGACCTGTCCGGGGGTTTACAGGACTGCACTGCATTGCATATCTGG
GGATTGCCGAAATTGCGGCGGCCATGGTGAGAATGAAAAGATGGGATCTG
AACGGACGTGATTCTATTGATGCAACCCCATTAATGTGGGCTTGTAGATA
CAAGAATTACAGCGTGACAAAGCTCCTTCTTGCAGAGGAAGATGTTGATC
CTAATTTACCGGACCATGACGGCCTAACACTTCTTTCCCGGGCTTCTAGG
TCTGGGG

Sequences in the Contig:

SY0AAA5YN18FM1