Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YM02FM1
Length(NT) : 605
Best Gene Model Blast : Link to GSTUMT00003158001 E-value : 1e-142
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU05214
Accession: ref|XP_962213.1| Score: 167 E_value: 6e-12
KEGG Definition: hypothetical protein
Accession: ncr:NCU05214.1 Score: 167 E_value: 3e-12
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0162 Score: 113 E_value: 1e-06
PFAM Definition: RNase_H1_sml, Ribonuclease H1/H2 small subunit. This family represents the small subunit of the mammalian RNase H1 and RNase H2 in yeast, the activity of which was found to rise during DNA replication..
Pfam Number: pfam08615 Score: 193 E_value: 6e-16

Sequence:
>SY0AAA5YM02FM1
TTGGCGGAACCAAAAACAAATAAACAGACAAAACATGCTCGCGATCCACC
CCTCCAAGGAAACCCCCGGAACGATCCACCTCCTCCCCTGTCATGTTAAA
CATACCGGGAGTGCAAACGCTACGAAGCATTGGGTTGTGAATGCTGGTGA
AGTTGACGGTTTCTAATTCCCACTCTTTTCTTTTCATGCTCGGTTGGGAT
GTGCTAATTGGGGGTGTGGCGTGGTGTGGGGTTTGTTGGGTCGGGCTCGT
AGGGACTAAAGTTGCGCATTTTCGTGGGAGGAAGTTAGTTGGGAAGCCTG
TTTCGCTGCCGGAGGGGTATTCTGGGCATGTATTAACGGTTACGGATGAA
GCCCCCAAGGGTGCGATTGAGAAGTCGAAGAGGAATCGGCCCATGGAGGA
GGAGGGAGAGGAGAAGAGAGAAGTCAAGGTGTTTAAGGGGTTGGCGAATT
TTGATGATGTGGTGGTTTGGGGTCATGATATAGCGCCAGAGGAGGGTGGG
GAGTATGTTGTAAAGGGTATGAATGAGTGGGTTGGGCTGGCGAGCAAGAT
TCACAGCTTTGGGGATGAGGGCGAGGAGTCGGTGTAGATGATTTATCATA
TTATG

Sequences in the Contig:

SY0AAA5YM02FM1