Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YL16FM1
Length(NT) : 622
Best Gene Model Blast : Link to GSTUMT00006395001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08165
Accession: ref|XP_001241002.1| Score: 494 E_value: 3e-48
KEGG Definition: mRNA transport regulator (Mtr10), putative
Accession: afm:AFUA_7G05970 Score: 468 E_value: 1e-45
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2081 Score: 320 E_value: 1e-30
PFAM Definition: Xpo1, Exportin 1-like protein. The sequences featured in this family are similar to a region close to the N-terminus of yeast exportin 1 (Xpo1, Crm1). This region is found just C-terminal to an importin-beta N-terminal domain (pfam03810) in many members of this family. Exportin 1 is a nuclear export receptor that interacts with leucine-rich nuclear export signal (NES) sequences, and Ran-GTP, and is involved in translocation of proteins out of the nucleus..
Pfam Number: pfam08389 Score: 133 E_value: 5e-09
Swissprot: Q9USZ2|YNR7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005635 = Cellular component: nuclear envelope
GO:0005525 = Molecular function: GTP binding
GO:0008565 = Molecular function: protein transporter activity

Sequence:
>SY0AAA5YL16FM1
TTGGCAACCACTACCACCAACCCCGTTCCCACCGATAGTCCTGATAATCT
TGAGCACCGCAATCTTTCGTTAATCAAATCTCTACACATACGCAGCATTT
TCTCTCGCTAAATTCCACACGATGGCTTCGCCAAATGGGCCCTCTGATCA
GTTTGCGCCCGTGCTCGCGGCTTTGGCGACCATGCAGGGCAACGTCGACC
GGGAGCAAAAGTACCAAGCTACACAGTTCCTGGAGCACTTTCAAAAATCG
CCCGAGGCATGGACTGTTGTGCACGCTATTTTACAGTCTGAGAACGCTGG
TGTTGAGGCACAACTTTTTGCTGCGACAACATTGAAGGGAAAGATCACTT
ACGATATTCACCAACTACCACGGGATGCCCTGGTGGATCTAAGGAATTCC
CTATTGAGCCTACTTGTTGCTCACCGGAACGGCTCACGCCCGATACGAAC
GCAATTGTGTGTCTGTTTAGCCAGTCTGGCCTTACAGTTGCTGGAGTGGA
AGGACGTTATTGGTCTGGTAGTTAGCACACTGGGAAATGATGTGGAGAGC
AGTGTGTGTTTATTGGAATTTTTGAAAATCCTCCCCGAAGAGGTTACTGA
AGGGAGGAAGGTTAGCTTGACG

Sequences in the Contig:

SY0AAA5YL16FM1