Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YJ17FM1
Length(NT) : 661
Best Gene Model Blast : Link to GSTUMT00011518001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213506.1| Score: 132 E_value: 3e-06
KEGG Definition: hypothetical protein
Accession: ang:An13g00980 Score: 130 E_value: 2e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA5YJ17FM1
TTGGCCAAAATGAAGAGCATGGAAAAGCACTTCGACGAGAGTGAAAAGAA
AGCCATCCTCGAAGCCGCAAAACAGAAATTCGCCCGAACCACCCAGCTCA
TGGAAGCTATCGAGGAAAGCATCGAGCGCGGCCTGACCGCTGAATTGAAC
TACACTGAGGAGCTCACGCAGGCTGTGACGCCGCTCCTTACCAATCCACT
GCGCACGGCAAGCTTCAAAGCGGATCTTCTTTACACTCTCGAACTTCTCT
CAACCCTGAAAGAAAAGAGTATAAAATTCATGAAAGCCTTCCACTCCGCA
AGTCTTCTGATGAATGAGTCCACCGCGGAGGTTGGTGTCGCCGAGGGCCG
GGAGAAGGGTGAAGTTGCAAAGGAGCGGTTAGGCTCTGATGAGGAGGCGG
AGAAGGAACTGCGTGAGAGAGTCAACGTAGTGAACAGTGATTGGACCGTT
GTAGAGAGCGGTATTCAGGGTGTTTTAGAAATGCTAAAGAATGTTTCTGA
GGAAAGCGCTGCAGTGTCTGGCGATGGGGGAGTTAGTCTGAGTGGCGGAT
ACGGAGATGCTAGTCATGGGAACCCTCCAAATCATGGTGTAGGTGGGGGA
GAGATGAGTGCGCTTGAAAGGGCTAAAATGAGGAATAAAGGTAGCATTGG
AATCATGTACG

Sequences in the Contig:

SY0AAA5YJ17FM1