Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YH04FM1
Length(NT) : 617
Best Gene Model Blast : Link to GSTUMT00001987001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_367231.2| Score: 464 E_value: 8e-45
KEGG Definition: conserved hypothetical protein
Accession: mgr:MGG_07156 Score: 464 E_value: 4e-45
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O43301|HS12A_HUMAN

Sequence:
>SY0AAA5YH04FM1
CACCGAACCTATCTCTCAACACGAAGATCCCTTGTTATTTTTGGCCAGCA
ATGAACTCGCCAAAGTCGGATACTAGCCTACGCAATATAGCCGAGAAGAT
CAAGGATGTATCTATCTCTGGGGAAGCGAATAGGATCGTTGTTGGTGTGG
ACTTTGGCACAACTTATAGCGGGGTGGCCTGGGGTTATACTGGATCGCCG
AGCGAGATACACGTTATTCAGAGCTGGCCTGGTGGAATGAACCTGACTTC
CCCGAAAGTCCCATCGAAGATTGCCTACGAAAAGGACGGAATAAAATGGG
GTTTTCAAGTGAAGCCTTTTCAAAATTGCATCGAGTGTTTCAAGCTATGC
CTAGATCCCAACTTGCGTCCCCCGGACTTTGTCTCCTTGCCCAATATCTA
TGCGCAGCTCAGACAGCATGATAAAGTCGTGCAGGATGTCGTTCGGGATT
ACTTGCAGATGCTATACGATCACACCATCACTACGCTGACACGAGCGCTC
GGAAGTACGTTTGTGGATAACACTAGGATCGAGTTTATTCTTACATGCCC
GGCGGTGTGGAGTGACCGGTCGAAAAATGCGACGCTCCAGGCGGCGGAGG
GGACGGGCATGGCCAAG

Sequences in the Contig:

SY0AAA5YH04FM1