Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YF20FM1
Length(NT) : 602
Best Gene Model Blast : Link to GSTUMT00010450001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG03962.1
Accession: ref|XP_384138.1| Score: 436 E_value: 1e-41
KEGG Definition: hypothetical protein
Accession: fgr:FG03962.1 Score: 436 E_value: 6e-42
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA5YF20FM1
TTGGCAATTTCTCTAGGAAGGCACATCCTATTGAGGATATAAGCGAGGTG
GAAATAAGGCAGAGATCTATGGGGAGCAAGATGGTTCTTGCTGGGAGGGT
ATTTTACGCTGGATTTGTTTGGTGCATGAAGGTTTGTGTGTTGGGTTTCT
ATGAACGGTTGACCGCGCGTTCGAAGCCGTATGGACTTTTGATCGATATT
ACATACGTTACTCTTTTCTTGACCTATGTGGCGGTCGTTTTCGTCACGTT
TCTTGAGTGCCGGCCGTTCCCAGTATATTGGCAGATGATACCCGACCCAG
GACGTTGCGTACAGGCAGTTGCGCAGCTAGTGACAATGGGTTCCCTCAAT
ATTTTGACCGATGCAGCCCTTATCCTTATTCCTTTACCCTTGGTCTTTAG
AGCTCGTCTCCCGCTCATCAGAAAGATCCAATTGTTCCTCCTCTTCGGCG
TTGGTATGTTCGTCGTCAGCATAACAATGATCCGCATGCCCGTGATTATA
AACGACAAATCTGCACAAAAAGCTCGGACGCTGTGGGCATCAATAGAGTG
CCTAGCAGCCTGCGTAGTCGCCAACGCACCGGTCCTGAACTCGCTCCTCC
GA

Sequences in the Contig:

SY0AAA5YF20FM1