Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YF15FM1
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00005352001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_09508
Accession: ref|XP_001551802.1| Score: 203 E_value: 1e-14
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA5YF15FM1
TTGGGTCAAGGTCTACTCCAGACCCACTTGGTATCGTACTTACAGCACTC
GAGTACTAGTACGAGTACAATGACAGTATCATATCTTTGAGACAGCGCTG
GTTTGGCTAAGGTTTTGCACACCATATATGGAGGAAAAACAAACTCATCT
GCACCGCTCCTACATCACCCTCTTCCGCCCTTCTATGAGACGTTACCACC
TTCTTCCCCACAACATACGGGCCCCACCGGTATCCCGATTCTTGCAGCTA
TGATTTTCAGATACCGCATTGCTCGGGAAGCCTGGGGTAGCCGTATCGTT
CCCGGGATCCTCCAATCGTCGTCCGTACTTGCCCGGCAAGCTTTGTCCCT
CTTTCGCCCAACGGTCCTAACGCCCGCCACAACTACCCTCCCTCCACCAT
CAAAGGAACAAATTCAAGCCATCAAGATCATACAGACTAGCCGAAGCAAT
ATCCTTATCAATGCGTGTGCGGGTTCCGGGAAAACCACCACAATCCTTCA
GCTGGCCGCCGCGTCGCCGGACCAGAATTTCCTGATCCTTGTTTACAACA
CTCGCTTGATGATGGAAACCAATCAACGCATTGCAAGCCTGGGACTGGAA
AATG

Sequences in the Contig:

SY0AAA5YF15FM1