Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YD07FM1
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00001152001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Dicer-like protein 2
Accession: sp|Q2UNX5|DCL2_ASPOR Score: 437 E_value: 1e-41
KEGG Definition: dsRNA-specific nuclease Dicer and related ribonucleases
Accession: aor:AO090001000193 Score: 437 E_value: 5e-42
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0354 Score: 250 E_value: 1e-22
PFAM Definition: Helicase_C, Helicase conserved C-terminal domain. The Prosite family is restricted to DEAD/H helicases, whereas this domain family is found in a wide variety of helicases and helicase related proteins. It may be that this is not an autonomously folding unit, but an integral part of the helicase..
Pfam Number: pfam00271 Score: 162 E_value: 2e-12
Swissprot: Q2UNX5|DCL2_ASPOR

Sequence:
>SY0AAA5YD07FM1
TTGGGGAGAGTATGTGGATGGAGTGGAACAACGAGGAAAAGCGCTATTTG
AAGTCGATTCTTTCGAAAATAGCTGTTCCCAGGGACATTGGTCCAATAGA
AGGGAGGCTTTCGGATAAGGTTGAGAAGCTGATTGAAGTGCTTCTGGGTG
AGCATAAGGATGATGGTGGGAAATTTGCGGGATTGATCTTCGTTGAGCAG
CGGGTGGGGGTCTCTATTTTGGCAGAAATCCTGAAAACGGATTCGAGAAC
GAAAGATATATTCCGAGTCGGAACTGTTGTCGGCGTTTCAGAAGGCAATG
GAAGGACTAGAAAAGCTATATATGAACTTGTTAACCTGAAAGGACAGTAC
GAGACAATTGAGGATTTTAGGGCTGGTAAGAAGAATCTAGTCGTGTCTAC
TAGCGTCGTTGAGGAGGGTATGGATATTCCAGCGTGTCGCCTTGTCGTTT
GCTTCTCCTTGCCGCCAAATCTCAAGAGCTTTATTCAACGTCGCGGACGG
GCGAGAATGGCTAAGAGTAATTATGTTTTGATGTTTAACGAAGGCGATAC
TCAGGGAAAGATTGATAAATTCAAGCAGCTGGAGATGGACATGATCGAGG
AATACCTGGATGAGAC

Sequences in the Contig:

SY0AAA5YD07FM1