Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA5YD03FM1
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00002118001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: phospholipid-transporting ATPase, putative
Accession: gb|EDP54420.1| Score: 822 E_value: 3e-86
KEGG Definition: hypothetical protein
Accession: ang:An12g04500 Score: 821 E_value: 2e-86
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0206 Score: 770 E_value: 8e-83
PFAM Definition: No Hit Found
Swissprot: P39524|ATC3_YEAST
Gene Ontology:
GO:0005802 = Cellular component: trans-Golgi network
GO:0004012 = Molecular function: phospholipid-translocating ATPase activity
GO:0005515 = Molecular function: protein binding
GO:0006897 = Biological process: endocytosis
GO:0006886 = Biological process: intracellular protein transport
GO:0045332 = Biological process: phospholipid translocation
GO:0006892 = Biological process: post-Golgi vesicle-mediated transport
GO:0000028 = Biological process: ribosomal small subunit assembly and maintenance

Sequence:
>SY0AAA5YD03FM1
TTGGGCTATCTACGACAAGGCCGCCACGACAATAAATAATCGTGGAGAGG
AGCTCGATAAAGCCGCAGAACTCGTTGAGAAGGAACTCTATCTGCTTGGT
GCGACGGCTATCGAAGACAGACTCCAAGACGGTGTCCCCGATACAATTCA
CACATTACAGACGGCCGGCATCAAAGTTTGGGTTTTGACCGGCGATAGAC
AAGAAACTGCCATTAACATCGGAATGAGTTGTAAACTCATTAGTGAGGAT
ATGAACTTAGTCATTGTCAACGAAGAGGACATGGAAAGCACAAGGAACGA
TTTGAGTAAGAAATTGGCAGCTATCAAAGCGCAAAAGAGCTCCGGTGCTG
AGCCAGAGGTGAAGCGCCTTTCAGGGATATGACAAAATTTGTACTTATTT
GTCCAGGCCCTAGCTCTAATCATTGACGGTCGCTCCCTCACCTTTGCCCT
TGAGAAGGATCTGGAAAAGACCTTCCTCGATCTTGCTGTTCTATGCAAGG
CTGTCATCTGTTGTCGTGTCTCCCCCCTCCAAAAGGCCCTCGTTGTCAAG
CTTGTGAAACGCCACCTCAGAGCCATCCTGCTCGCCATCGGAGACGGTGC
GAATGATGTTAGTATGATTCAAGCAGCCCATGTCGGCGTTGGCATCAGCG
GCGTGGA

Sequences in the Contig:

SY0AAA5YD03FM1