Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA59YJ20FM1
Length(NT) : 113
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06960
Accession: ref|XP_001797317.1| Score: 158 E_value: 1e-09
KEGG Definition: RNA polymerase II transcription initiation/nucleotide excision repair factor TFIIH, subunit TFB4; K03143 transcription initiation factor TFIIH subunit H3
Accession: aor:AO090026000670 Score: 128 E_value: 2e-06
KOG Definition:
Classification: [Transcription, Replication, recombination and repair].
Kog Number: KOG2487 Score: 116 E_value: 1e-07
PFAM Definition: Tfb4, Transcription factor Tfb4..
Pfam Number: pfam03850 Score: 124 E_value: 2e-08
Swissprot: O74366|TFB4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA59YJ20FM1
TGTTTCCGGCGACCTGGCGGAGCAGTACGTTCCTGTTATGAATTCGATAT
TCGCGGCGCAGAGGAAAAAAATACCAATTGATATATGTAAGGTTGCTGGC
GAGACCGTGTTTC

Sequences in the Contig:

SY0AAA59YJ20FM1