Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA59YH20FM1
Length(NT) : 201
Best Gene Model Blast : Link to GSTUMT00006856001 E-value : 1e-111
Numbers of ESTs : 1

Blast Results:

Nr Definition: hexokinase
Accession: gb|AAG28789.1|AF309088_1 Score: 346 E_value: 2e-31
KEGG Definition: hexokinase [EC:2.7.1.1]; K00844 hexokinase
Accession: mgr:MGG_09289 Score: 289 E_value: 3e-25
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1369 Score: 208 E_value: 4e-18
PFAM Definition: Hexokinase_2, Hexokinase. Hexokinase (EC:2.7.1.1) contains two structurally similar domains represented by this family and PFAM:PF00349. Some members of the family have two copies of each of these domains..
Pfam Number: pfam03727 Score: 222 E_value: 8e-20
Swissprot: P80581|HXK_EMENI

Sequence:
>SY0AAA59YH20FM1
CTACCAGAATCGGTTGCATCTTCGGTACTGGTTGTAATGCTGCCTACATG
GAGACCGTTGGCTCTATTCCTAAGCTTGCTCATATGAATCTTGATCCTAA
ACTCGATATTGCTATTAATTGTGAATGGGGGGCGTTCGACAATGAACATC
GTGTCCTTCCTCGCACTGTATATGACAAGCATATCGATGAGCACTCTCCC
G

Sequences in the Contig:

SY0AAA59YH20FM1