Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA59YF14FM1
Length(NT) : 100
Best Gene Model Blast : Link to GSTUMT00007997001 E-value : 2e-51
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0188 Score: 101 E_value: 7e-06
PFAM Definition: No Hit Found

Sequence:
>SY0AAA59YF14FM1
TCTTTTCGCTCTAGCACCGCGAACATCTCCCGTTATACTCAGCTTGGCCT
TATTCTTGACAAGACAAATTTCTATGCCGAACAAGGGGGTCAGGAATACG

Sequences in the Contig:

SY0AAA59YF14FM1