Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA59YB18FM1
Length(NT) : 422
Best Gene Model Blast : Link to GSTUMT00008238001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: will die slowly
Accession: gb|EDS27166.1| Score: 531 E_value: 7e-53
KEGG Definition: GA14510-PA
Accession: dpo:Dpse_GA14510 Score: 531 E_value: 3e-53
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0266 Score: 385 E_value: 2e-38
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 133 E_value: 2e-09
Swissprot: Q9V3J8|WDS_DROME

Sequence:
>SY0AAA59YB18FM1
TTGGCTCACCACGCGGCAATATCGTTGCCTCTGGTTCCTATGATGAGGCC
GTTCGTCTGTGGGATATCCGTTCGGGAAAGTGCATGAAAACCTTACCTGC
ACACGGAGATCCGGTTTCTGGTGTCCATTTCAATCGCGATGGGACAATGA
TCGTGTCCTGCTCTCACGATGGTCTGATACGGATTTGGGATGTTACTACT
GGCCAATGCCTTCGAACATTAGTTGAGGAAGATAATGCTCCTGTCATGGC
TGTTAAATTTTCGCCGAATGGGAAATATTTGTTAGCAGGGACTCAGGATA
GTTGTGTCCGGTTATGGGACTACCATCGCGGCAAATGCCTTAAAACCTAT
ATGGGACACAAAAATGACAAGTACAGTATATTTTCAACATTCATAATTGC
TAATGGCAGTTGCTTTGTAATG

Sequences in the Contig:

SY0AAA59YB18FM1