Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YO14FM1
Length(NT) : 434
Best Gene Model Blast : Link to GSTUMT00011672001 E-value : 3e-84
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG4364 Score: 125 E_value: 2e-08
PFAM Definition: Caldesmon, Caldesmon..
Pfam Number: pfam02029 Score: 105 E_value: 5e-06

Sequence:
>SY0AAA58YO14FM1
TTGGAGCGACTCGACCGCTACACCCACTCTCCCAATGTCTAATCCGGCAC
CAGCTTCAACTCCGACGCCTCCAGACTCTTTGCCGCATGCTTCTACCAAT
CCCGGTACCCCAGACTCTGTTAAAAAGAGATCACTTTCAGATATGGGCAG
CGATTCAACAAGAACAGAGGGTGGTAGTAAACTAGCTAGCGGTGATGGTG
ATGGTGATGGTGGTGGTGATGGGAATGCCATGGGTCTTGGTACCGGCGCA
GTCGGGCCAGCCAAGAAGAGGACAAAGTTGACCGAGGCTGAGAAAGAAGC
TAGAGAGAAAGAGAGACTCGAGAGGGAGAAGGAGAGAGTTACCAAGGAAA
AAGAAAGGCTTGCTAAAAAAGCTGAACGGGATGAGAAGAGACGTATTAAG
GATGAGGAGAAGAAGAAAAGGGAAGATGAGAAAG

Sequences in the Contig:

SY0AAA58YO14FM1