Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YN17FM1
Length(NT) : 443
Best Gene Model Blast : Link to GSTUMT00005658001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Delta(14)-sterol reductase
Accession: ref|XP_001591653.1| Score: 220 E_value: 8e-17
KEGG Definition: hypothetical protein
Accession: ang:An18g03480 Score: 194 E_value: 4e-14
KOG Definition:
Classification: [Lipid transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG1435 Score: 196 E_value: 2e-16
PFAM Definition: ERG4_ERG24, Ergosterol biosynthesis ERG4/ERG24 family..
Pfam Number: pfam01222 Score: 192 E_value: 5e-16
Swissprot: O13597|ERG24_SEPLY
Gene Ontology:
GO:0050613 = Molecular function: delta14-sterol reductase activity

Sequence:
>SY0AAA58YN17FM1
TTGGCGAGATTTCGTGGACATATAAACTCATTCCTTCTTCCCTACTTTCT
TGGTGACAACAAACGCGACTTAAAGATAGTGATCATGCCTCCTCCAGCTC
ACGGATATGAATTTGGCGGGCCTTTGGGGGCCTTTGCTATTTCACTTGCT
GCACCAGCAGCCACATATGCTCTTTACTTTGTCTGCAATGAAGATGGGTG
CCCGAGTAGTTCATTCTTACGAGATCCGGTTGGGAATATTGCTTCGAAAT
GGCCGGGACTGTCGGGAGCATTCGACTGGGGCGTTACGAAGCACTACTTT
CTCTGGTATTTCGCCTTGGCAATTATGTACTTTGTCCTTCCGGGGAAGAT
AGGGGATGGTGTTGTGTTGAGCAATGGGAGGAGGTTGAAGTACAAGTTTA
GCGGCTCTGCTTCTCTCTTGACTGTTTTTGCGTACTGTGGATT

Sequences in the Contig:

SY0AAA58YN17FM1