Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YL03FM1
Length(NT) : 545
Best Gene Model Blast : Link to GSTUMT00010584001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 197 E_value: 5e-14
KEGG Definition: hypothetical protein
Accession: ani:AN3320.2 Score: 175 E_value: 9e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA58YL03FM1
TTGGGGGAGTTCCTACTTCAGGGATCTTTTCCTGGCATGGGAAACTGGCA
GTATACCCTATGCCCCGAGGATTCAAACTTCCTTTTGGCTGACATTTGTA
TTGCCTATCTTTCACTTGAGGACTTTGAAAACGACCCATTAGTGGTTGAT
ACTTTCGACGACTACAGAATGCCCGCGGCCCAACGGTATCTCCAGAAATA
CGACTTTCTTGATTATGCAGCTAGAAACTGGGCCGACCACTTTAGAGATT
CGCGGGATCAGCAAATGAGATTATTCGAGTTTACACGACATATTTGTGAA
GGTGGATCTAAACGCTTTCTGACCTGGTTGAAAGTGTACGGGTTCGGCGG
TATGATTTGGTATAGATGCTCCAGAGGCTTCACATATTTGATGATGGCAT
CGTGGTTAGGCCAAACGGCGGTAGTTCAGCAACTATTGCGGGAGGGCGGA
GATGTGGATGGTCGATGCGAAATCTATGGCACCGCATTAAACATCGCAGC
TTACCGGAAAGACGCGGGTATTACCGAAATGTTGGTGGAGAAGAA

Sequences in the Contig:

SY0AAA58YL03FM1