Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YK22FM1
Length(NT) : 437
Best Gene Model Blast : Link to GSTUMT00004991001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 116 E_value: 3e-07
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 114 E_value: 4e-07

Sequence:
>SY0AAA58YK22FM1
TTGGCATTGCTCATGGAACATCAATGGTCGATGGCTTTACCACCACCTTG
TCCACCATGACCAAGACTAAGACTTTGACATGGACCGTCATGGTTCCTTG
CACCACCGTTGCTGCCGGTACAACTAGCTACTACACCACCGCCTCGGTGT
ACACCACTTACGTGTCGGACCTGAAGACCATCACCATCACCTCCGCCTGC
ACAAAGTGTGCTTACGCCACTCCCACACCCGCTGGCCCAGGAGGTTCAGT
AGCACCCGATACCACCATCATCAAACCCGCCGACTCGACCCCCACTAGCT
CCGTCAAGATAATTCAGGAGATCAAGACCGTTGTTCCGATCGTTGTCTCA
GCCGGACAAACCACCACTGCTCCCGCGGCCAGCGTTCCTTCTAACCCTAC
TGGCCCTGCTAAGGGTACCACCTCTGGCTTCAGCGGA

Sequences in the Contig:

SY0AAA58YK22FM1