Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YK05FM1
Length(NT) : 599
Best Gene Model Blast : Link to GSTUMT00011697001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_11068
Accession: ref|XP_001801319.1| Score: 167 E_value: 2e-10
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA58YK05FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCATCCAAATCCTTGGAGAAT
GAAGTTGGTGAATGTGCAGTTTTGGGTCTACCGGAACTGGAATTATTGCT
GTGAGAAGAAAACGGGGACCAATAGGTATTGTGAGTTTCTGGTTGCAAAG
CCGGACTGGGCATTCACCAACTTCATTATCCAAATCCTTGGAGACAGTTA
ACCATCAAAAAAGGAAATTCCTAGGAGAGTTGAAGCAATCACTAACCGGC
CTTCTCTTGAGTGACCTTGGTCTGGAGGTCTTCAGCAAGGGCAGTGAAAC
AGACGGATGGTTTTCGGGTGGCCTAGGTGATGAGTGTATCCAGAGGAAGG
AAGAGCAGGAAGAGGCCAAGCGAAAGGTTCCGGAGAAGCAATCATCAAAG
AACAGTGGTGGATCTGGCAATAAGAAACTGGCTAGAAAGAAGAGCACCAA
AAACGTTCGGAAATCCGCTAACACGGGCACTTTTGAGGCTTTAGGCAAGG
AGAAAAAGGGAGAGTTGGCGGCGCCGGTTGCCACTTTAGAAAATGTTGGC
CGTGAAGCCCACTCTGGAGAGGAGAACTCATCATCTAGCGATGCCACTG

Sequences in the Contig:

SY0AAA58YK05FM1