Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YI22FM1
Length(NT) : 421
Best Gene Model Blast : Link to GSTUMT00004324001 E-value : 1e-148
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein NCU03546
Accession: ref|XP_956825.1| Score: 206 E_value: 3e-15
KEGG Definition: hypothetical protein
Accession: ncr:NCU03546.1 Score: 206 E_value: 1e-15
KOG Definition:
Classification: [Transcription, Lipid transport and metabolism, Signal transduction mechanisms].
Kog Number: KOG1620 Score: 158 E_value: 3e-12
PFAM Definition: IPK, Inositol polyphosphate kinase. ArgRIII has has been demonstrated to be an inositol polyphosphate kinase..
Pfam Number: pfam03770 Score: 165 E_value: 5e-13
Swissprot: O74561|YCZ8_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAA58YI22FM1
TTGGGATGAAGGTTACGGAGGCGACCGGGAAGACGAAGTATTTAAGATGG
ACGAAGATGAAAGCATTCCAATTGGAAAGAAGACTTGGGCAACCAGATGC
TTGGACCGAAGAGCCCCAACACCACCACCATCACCACCATCAGTCCCCTC
TACTGCCTCGGAAAGCACCTCACAGACACAGCAGCCCCAACCCATTCCAT
CACCTCTCTCTATCCCTCCGGCAACAGAATCTCCAGACCCTGGTCGCCAT
CAACGAAACCCCTAATATCCCTATACCCAAAGAAGTACTACAGCAGCCCA
TCGAACGGGTGGAACATTTCCTTCTCCTCGAAGACCTGACAGCGGGCATG
AAGAGGCCCTGTGTCCTTGACCTCAAGATGGGAACCCGGCAGTATGGCGT
CGAAGCCTCTAAGAAAAAAAA

Sequences in the Contig:

SY0AAA58YI22FM1