Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YI16FM1
Length(NT) : 592
Best Gene Model Blast : Link to GSTUMT00010616001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_08333
Accession: ref|XP_001241170.1| Score: 874 E_value: 2e-92
KEGG Definition: nucleolar GTPase, putative
Accession: afm:AFUA_4G08930 Score: 870 E_value: 3e-92
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2423 Score: 939 E_value: 1e-102
PFAM Definition: MMR_HSR1, GTPase of unknown function..
Pfam Number: pfam01926 Score: 182 E_value: 1e-14
Swissprot: Q6C036|NOG2_YARLI

Sequence:
>SY0AAA58YI16FM1
TTGGGCTGTTGCTTTCTGGGAAGAGTGCCGAGGAGAAGGAGGAGGAGGGA
TGGATTCAGGAGGCGAGGGAGCCGATTTTCTCGAAGGGGCAGAGTAAGAG
GATTTGGAATGAGTTGTATAAAGTCATTGATTCTTCTGATGTCGTGATAC
ATGTCCTTGACGCTAGGGATCCCTTGGGAACCCGCTGTCGCAGCGTGGAA
AAGTACATCAAAGAAGAGGCCCCCCACAAACATTTAATATTCGTCTTGAA
TAAATGCGATCTAGTTCCCACTAGTGTTGCGGCTTCATGGGTTCGCCGGT
TGTCAAAAGACTATCCGACTCTTGCCTTCCATGCGTCTATCAATAACTCG
TTTGGGAAAGGTTCTTTAATTCAGCTTCTTCGCCAGTTTTCTGCTCTACA
TTCGGATAGGAAGCAAATTTCTGTTGGCCTCATTGGATATCCTAATACTG
GGAAATCCTCTGTCATAAACACATTGCGCAAGAAGAAAGTCTGTACAGTG
GCACCTATTCCCGGGGAGACAAAAGTCTGGCAGTACATTACTCTTATGCG
CCGTATCTTCCTGATCGATTGTCCTGGTATCGTCCCCTCCTT

Sequences in the Contig:

SY0AAA58YI16FM1