Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YI08FM1
Length(NT) : 497
Best Gene Model Blast : Link to GSTUMT00011095001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE60691.1| Score: 650 E_value: 1e-66
KEGG Definition: transketolase [EC:2.2.1.1]; K00615 transketolase
Accession: aor:AO090012000526 Score: 650 E_value: 6e-67
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0523 Score: 485 E_value: 6e-50
PFAM Definition: Transketolase_N, Transketolase, thiamine diphosphate binding domain. This family includes transketolase enzymes EC:2.2.1.1. and also partially matches to 2-oxoisovalerate dehydrogenase beta subunit EC:1.2.4.4. Both these enzymes utilise thiamine pyrophosphate as a cofactor, suggesting there may be common aspects in their mechanism of catalysis..
Pfam Number: pfam00456 Score: 595 E_value: 1e-62
Swissprot: Q12630|TKT1_KLULA

Sequence:
>SY0AAA58YI08FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCGAAGTCGAAACGAACACC
AGTCTTACTTCAGATACTCATTCGCTCATCATGACTTACGGCGAACTCGA
CCAATTGGCTATCAACACAATTCGTATTTTAGCGATCGATGCTACTTCCG
CGGCAAACTCCGGCCACCCTGGTGCGCCCATGGGAATGGCCCCCGTTTCT
CATGTCCTTTTCAACAAGTTTATGAGGTTCAATCCTAAGAACCCCTCATG
GGTCAATAGGGATCGGTTTGTTCTATCTAACGGTCACGGTTGCATGCTTC
AATATGCTCTGTTGCACCTTTTTGGCTACGACCTCAGCATTGACGACTTG
AAGGCTTTTCGTAAAATTGGATCTAAGACGCCTGGTCACCCTGAGGCAGC
TGATACCCCTGGTGTCGAAGTTACCACTGGCCCTCTCGGCCAGGGTTTTT
CCAACGCTGTCGGTCTTGCCATTGCTCAAGCCCACACCGCTGCCGTC

Sequences in the Contig:

SY0AAA58YI08FM1