Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YH20FM1
Length(NT) : 481
Best Gene Model Blast : Link to GSTUMT00011594001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: ATP dependent RNA helicase, putative
Accession: gb|EDP54341.1| Score: 171 E_value: 4e-11
KEGG Definition: ATP dependent RNA helicase, putative
Accession: afm:AFUA_2G07950 Score: 171 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA58YH20FM1
TTGGCATACTGATATTTTCACTTCTATCATACGATATTCGAGAAAAAGAG
TTCGAATTTCGAAATGGGTGGAAAAAAGAAAAATAAAGTTGCATCTAATC
CTGCACGCGGGTTTGCTACTACATCAGTGCCATCCAAAACGAAAACACCT
GCCCCAGTCCCCGAAGGTCCAAGTGAAAAAGAGACCGACACTGTTGTGGC
ATCGGGGCCTTCAGAGAAGGACTCGGGAAAGGCCGGTGAGATTCTAGGTA
TCCCGAACGAAGAAGAGGTGGAGGAGCACCGATTGAAGGCACTTGTGGAC
AAGCTAGGTCAAAGGGCCAGGAAGGAAACACAGAGAATTGTGGCCCGGGT
GGAAGTCGAGAAACGCACAATTAGAAGTATCTGCTACCCTTTGAAGGTGA
ACAAACTTCTAGAGTTTGACTTCGTGCGTTATAATAGTCAGCCAAGGACT
ACTGGTGGAGTGAAAGAACTTGGGGTAGGGG

Sequences in the Contig:

SY0AAA58YH20FM1