Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YF22FM1
Length(NT) : 405
Best Gene Model Blast : Link to GSTUMT00005932001 E-value : 1e-160
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 252 E_value: 4e-24
KEGG Definition: ankyrin repeat protein
Accession: afm:AFUA_3G02830 Score: 217 E_value: 7e-20
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 172 E_value: 8e-14
PFAM Definition: Ank, Ankyrin repeat. There is no clear separation between noise and signal on the HMM search Ankyrin repeats generally consist of a beta, alpha, alpha, beta order of secondary structures. The repeats associate to form a higher order structure..
Pfam Number: pfam00023 Score: 102 E_value: 9e-06
Swissprot: Q7T163|ARMS_DANRE

Sequence:
>SY0AAA58YF22FM1
TTGGCGAAAGCGTAGTCAAGCTATTACTCCAGCATCGAGACGTTGATCCC
AACTCGCCAGATGATCACGGCCAAACACCACTCACGCGAGCCTCTTGGAG
GGGAACGAGGAATTAGTCAAGCTATTACTTGAACGAAAAGACCTAAACCC
CAACACGCCCGATGCGGTATACGGTCAAACACCCCTTTCCTGGGCAGCGG
AGAATGGAAACGAGGAAGTCGTGAGACTGCTACTAGAGTGCGATGGTCTC
GACCCCAATCATCCAGACATCGAGTGCGGCCAAACGCCGCTCCTGTGGGC
CACGGAGAACGGACACGATGGAGTAGTGAATCTATTATTGCAGCGGGGAG
ATCTCGATCTGAACCAGTCCGATGCGGTATGTAATCGAACCCCGCTCTCC
TGGGC

Sequences in the Contig:

SY0AAA58YF22FM1