Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YE09FM1
Length(NT) : 521
Best Gene Model Blast : Link to GSTUMT00000129001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001247533.1| Score: 732 E_value: 4e-76
KEGG Definition: hypothetical protein
Accession: ani:AN1911.2 Score: 731 E_value: 3e-76
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1460 Score: 490 E_value: 1e-50
PFAM Definition: No Hit Found
Swissprot: O60064|YBB2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0006013 = Biological process: mannose metabolic process

Sequence:
>SY0AAA58YE09FM1
TTGGCTTTCGGACTCACGCCGTTTCTTTGTTTACGAAACGCGTGACTTTT
GGCGTCAGATCAAGACTGCTGGTTCGGCTGTCCCCGCCAATGCTCTCTAC
TTGCAGAAGGCCTGGCAATCGGAATCCAACGAACTTAGCCAGCCTTCCGC
ATTCATTGTTCCCCCTGTTTACATCCACCCGACTGCGGTGGTTGATCCCA
CAGCCAAGCTAGGCCCTAATGTTTCCATCGGCCCTAGAGCAGTGATTGGA
GCAGGCGCTCGTGTCAAAGAAAGCATTGTTCTAGAGGATGCAGAAATCAG
ACATGATGCCTGCGTTTTGTACTCAATTATTGGTTGGCAGAGCAAGGTCG
GCGCTTGGGCTCGTGTCGAGGGAACTCCAATGAGTGTGACGGAGCACTCC
ACGACAGTCGTCAAGAACGGCGTTCGTGTGCAAAGCGTCAGTATCCTCAG
CCGAGATTGTAAAGTTGGGGACGAAGTGAGAGTTTGGAATTGCGTCACTT
TGCCGTTCAAGGAATTGAAGA

Sequences in the Contig:

SY0AAA58YE09FM1