Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YD18FM1
Length(NT) : 461
Best Gene Model Blast : Link to GSTUMT00005309001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein B23I11.160
Accession: pir||T51904 Score: 223 E_value: 3e-17
KEGG Definition: hypothetical protein
Accession: ncr:NCU03336.1 Score: 223 E_value: 2e-17
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2427 Score: 148 E_value: 5e-11
PFAM Definition: No Hit Found
Swissprot: P53155|YGI2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAA58YD18FM1
TTGGGATGCCCGCATCATTAGAGAATTCATGGAAAAGAGTAAGACACAAT
TAACCATTCATGGGTTGGACGTATTAAGGAGAGATTTAAAGGCAGGACAT
GTTGCTATCTTATTTAGAAACGATCATTTCATGACTATTCTCGGTGGGGG
ACGGACTGGGGGTGATTTGGTTGGGCTAGTTACAGATATGGGGTTCGCGA
GCCACGAAGAGGTGGTTTTCGAGAGATTAGCGGATGTTCAAGGATGCCAA
AATGAATTCCTCAGCGGAGACTTTAGACCTGTCGGCGGTGGAGGTTCCGA
TACTCATAACAGTGGCGGTAGTTCGAGGCACCAAGCAGCGCCACGACAGG
AGGTTAGAAGCTTACTTGACGATGACGAAGGATGGCAGACCGTTGGTTCT
AGGAGAAGTCAAAATAATAGCCAAAGCCTAGCCACCACTATCGAGCGAGC
GCCTCCCCCAC

Sequences in the Contig:

SY0AAA58YD18FM1