Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YD14FM1
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00003026001 E-value : 1e-135
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_00724
Accession: ref|XP_001560696.1| Score: 142 E_value: 3e-08
KEGG Definition: hypothetical protein
Accession: fgr:FG01636.1 Score: 145 E_value: 4e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA58YD14FM1
TTGGGTTGTGTGACAGATAGGACGGGGGGCAGATCTCTGAAAGGGCCATC
ATTCTGGAGAAACGACAGATGGAGACTACTCCCGCTGATCAGATAACAGA
GGTTACTACACTGGTTGATACAGTTCTGTCGCCCGGTACGACTAAATCGG
CACCTGTAACTATAACGCGTGTGTCTACATCACTAGGAACCGCTTCAAGG
ACTTCATCTATTACACGTAAGAGGTTTCTTTTGAAAATGTGATCAATTGT
GGCACTGAGATGTATATATATAGTTACATCATCATCCGTATCTCCATCTC
CCACCTCAAGTGCACTATACTGCAACGCAGGGTATACCCTCTGTGGAGCC
GAATTCGGTGGTATGTATCACTCTCCACGTCTTAACTTACAGCATCTAAC
GCCCCGCCACAGGCGGATGCTGCAAAACCGGCTACACCTGTGCCCTAACC
GGCTGCGTCCCTCCTGCTGGAACAACCACCCCGCCACCTAGTCGAACGTG
CACAATTTCTAGCCAGACTCTCTGTGCCTCATCGATGGGCTTTGGCTGCT
GCGTCGTGGGCCAAGAATGCGGTTTCTCATCCTGCACCCCAGCAGGCGGA
TCCGCCGTGACCAAGGTCCCGGATGTCGATGCTAACAATCTTAAACTCTC
TGC

Sequences in the Contig:

SY0AAA58YD14FM1