Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YD13FM1
Length(NT) : 575
Best Gene Model Blast : Link to GSTUMT00008840001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001540967.1| Score: 737 E_value: 1e-76
KEGG Definition: Golgi complex component (Vps8), putative
Accession: afm:AFUA_1G05280 Score: 700 E_value: 1e-72
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA58YD13FM1
TTGGGTTTTCGACTACAACCAGAGTCTTCAAGGAATAATAGGGCCCGGTA
CAAAAGCTGTCGAGCATGGAGCAATATCAGCTCTGGCCGTTTCTGCCGAC
CATACCACCATCGCAGGAGGTCACGATTCGGGGCACATTTTCACTTGGGA
GTTGAACAAACCTAGCCAGCCATTTCTCCATATACCCCCTCTCCCTTTAG
ATCAGGTTGAGGGTCGAAAAACGGATGGTCACGTTGAAGGGGTTTCAGTA
ATTCATCTTGGGTTTCTTGGCACTAGACATACGGCATTGGTTTCTGGCGA
CGATAGAGGGATGGCATTCTCACATTTGGCGACTAGAGGGTTAGGCGCAG
TTAGGAGGGTAGTAAAAACTACGCGTGTTCTAGGGCGATATCCATTTGAC
GTTAATCCGTCGCTCCGACCTCGCAAGCCTAGTTCGGTACTTGGGTTCTC
AGTTCTCCCATTGGGGAACTTCCAACAAGCGACAGACACTCTTGGACTTG
TGGCCCTGTTGACTCCTAACCTCTTAGTCATTGTTTCAACTACTCCGATT
GCACAAACACAATATAAAGCTGCTA

Sequences in the Contig:

SY0AAA58YD13FM1