Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAA58YD09FM1
Length(NT) : 548
Best Gene Model Blast : Link to GSTUMT00005719001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09527
Accession: ref|XP_001239906.1| Score: 130 E_value: 3e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG07133.1 Score: 124 E_value: 8e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAA58YD09FM1
TTGGATATGATCCTGAGGCATGAGAACTTTAGCGATGATATGACGGTCGA
TATAAGGGTCGAAGAGAATCCTGCCTCATATCCACAGTATAATCTCCGAC
ACCCACAGATCATGTCTTATACTGGACCTGGGCCACGAGGCTCCTTCTCT
GGTGGAAGGAGCGTATCCCCTAGCGCTGCACGAGGGAGGAGAAGCGCCAG
TGCGGGTGGGCGCCCCAGGGGAATGAAGCGCCAAGCATCTCACCGAGGGG
AAGAGGAGCATTATGATGAGCGCTTCCCACAAGGATATTATCTACAACAG
CCCCCCCAACAGTTCTTGCCAGAGGAAGATGAGGAATCGGAATCGCGAAG
CAGGATTGAACCGGTGGCAAGTGCAGATATCAGTTTGGACAATATTGTTG
AGGGTTCAAGGAGGAAACGACCAAAATTCTCGTCTGATGAACTGCCACTG
TTCCCGCCTCCGGCCCTTCCTAGACAAGACGGTTCCACATCGTCATCAGC
CAGTCCTTCGCACCCTGCACCCCAAGTGACCACTCCTTATGGTAATCG

Sequences in the Contig:

SY0AAA58YD09FM1